Generation of PU6::sgRNA templates by PCR fusion
- Amplify PU6 from pJW1310 using oligos 1787 and 1788 (attgtgttcgttgagtgaccc and caagacatctcgcaataggagg, respectively). I use this PCR product repeatedly for fusion reactions.
- Amplify new sgRNA template using a target specific 60mer and oligo 1790 (aaaaataggcgtatcacgagg); use pJW1311 as a template for PCR
- Use 0.5 µl of each PCR product in a 100 µl PCR (I use Phusion for PCR fusion J) with the following parameters: The: i) 98ºC denaturation; ii) 35 cycles of 98ºC‑10 sec, 61ºC‑30 sec, 72ºC‑20 sec; iii) 72ºC 1 min final extension.
- Clean and concentrate PCR product (I like Zymo kit) and elute in 15 µl of nuclease-free water. Nanodrop. It’s now ready for injection
- If you need more PU6::sgRNA or if the product is dirty, perform a nested PCR on the fusion PCR with oligos 1793 and 1794 (aacgtcgtgactgggaaaacc and ggtgtgaaataccgcacagatgc, respectively).