• Home
  • Research
    • Molting
    • Spermatogenesis
    • Tool development
    • Past research
  • People
  • Publications
  • Methods & protocols
    • Biochemistry
    • C. elegans
    • Molecular biology
    • pha-1 co-conversion >
      • Strain maintenance
      • cku-80 RNAi
      • Construct and oligo design
      • Generation of PU6::sgRNA templates by PCR fusion
      • Injections
      • FAQs
  • Positions
  • Resources and links
    • Meeting slides >
      • 2017 Worm meeting
      • 2019 Worm meeting
    • K99 grant writing
  • Contact us
  • Blog
  The Ward lab at UC Santa Cruz

Generation of PU6::sgRNA templates by PCR fusion

  • Amplify PU6 from pJW1310 using oligos 1787 and 1788 (attgtgttcgttgagtgaccc and caagacatctcgcaataggagg, respectively). I use this PCR product repeatedly for fusion reactions.

  • Amplify new sgRNA template using a target specific 60mer and oligo 1790 (aaaaataggcgtatcacgagg); use pJW1311 as a template for PCR

  •  Use 0.5 µl of each PCR product in a 100 µl PCR (I use Phusion for PCR fusion J) with the following parameters: The: i) 98ºC denaturation; ii) 35 cycles of 98ºC‑10 sec, 61ºC‑30 sec, 72ºC‑20 sec; iii) 72ºC 1 min final extension.

  • Clean and concentrate PCR product (I like Zymo kit) and elute in 15 µl of nuclease-free water.  Nanodrop.  It’s now ready for injection

  •  If you need more PU6::sgRNA or if the product is dirty, perform a nested PCR on the fusion PCR with oligos 1793 and 1794 (aacgtcgtgactgggaaaacc and ggtgtgaaataccgcacagatgc, respectively).

Strain maintenance
cku-80 RNAi
Construct and oligo design
Injections
FAQs
PDF of methods and consideration
Powered by Create your own unique website with customizable templates.